DNA Invert Repeat Definition

An inverted repeat (IR) is a sequence of DNA that reads the same forwards on one strand as it does backwards on the complementary strand. This means the sequence is identical to its reverse complement. A common form is $S...RC(S)$, where $RC(S)$ is the reverse complement of $S$. A sequence that is its own reverse complement is called a palindrome.

Sequence Analysis for Invert Repeats

We examine the given DNA sequences to identify which one contains an inverted repeat.

Option B: Identifying the Invert Repeat

Let's analyze Option B: $ATGAGCCGGCTCTA TACTCGGCCGAGAT$.

The complete sequence is:

$ATGAGCCGGCTCTATACTCGGCCGAGAT$

This sequence contains the subsequence $CCGG$ appearing twice:

• The first instance of $CCGG$ starts at position 7.
• The second instance of $CCGG$ starts at position 20 (using 1-based indexing).

The subsequence $CCGG$ is a palindrome, meaning it is its own reverse complement ($RC(CCGG) = CCGG$). The presence of this palindromic sequence repeated within the larger DNA strand constitutes an inverted repeat structure ($CCGG...CCGG$).

Therefore, Option B carries an inverted repeat.